non targeting crrna sequences Search Results


92
Addgene inc pu6 dr crrna
Pu6 Dr Crrna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/non+targeting+crrna+sequences/pmc07758406-136-27-8?v=Addgene+inc
Average 92 stars, based on 1 article reviews
pu6 dr crrna - by Bioz Stars, 2026-07
92/100 stars
  Buy from Supplier

90
ACGT Inc crrna targeting the sequence aatctcgctcaagattacgttgg
Crrna Targeting The Sequence Aatctcgctcaagattacgttgg, supplied by ACGT Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/non+targeting+crrna+sequences/pmc07144083-68-17-24?v=ACGT+Inc
Average 90 stars, based on 1 article reviews
crrna targeting the sequence aatctcgctcaagattacgttgg - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

Image Search Results